Editing help with a perl script to start and stop at specific places in the array

Question

Seek troubleshooting help. This is homework. My professor recommends using forums. I have no experience with Perl functions or Subs, so please limit the answers to the appropriate level so that I can understand.

The purpose of the script is to read the DNA string (or a file from the command line, which I will add later), translate it into RNA, and then return the protein value in the form of uppercase single-letter amino acid names.

Script function:

• Take 3 “codon” characters from the first character and give them one character. Symbol (uppercase single-letter amino acid name from the hash table)

• Printing RNA proteins, which are lines starting with AUG ("M") and ending with UAG, UAA or UGA.

• If a space occurs, a new line begins and the process repeats. We can assume that spaces are multiples of triples.

The main problems, as far as I can tell:

• I do not know where the data cycle through the hash table will go. I tried to place it before and after my Foreach block. I also completely blocked the Foreach block and tried While and If.

• The Foreach block does not seem to process the entire @all_codons array and stops only on AUG.

• The obvious and biggest problem is that it returns nothing. Somewhere along the way, the value of $ next_codon is set to false. I tried to comment on each line in parts - the last line in which something was returned was My $ start and from there everything is false.

script:

$^W = 1;
use strict;


my $dna_string = "CCCCAAATGCTGGGATTACAGGCGTGAGCCACCACGCCCGGCCACTTGGCATGAATTTAATTCCCGCCATAAACCTGTGAGATAGGTAATTCTGTTATATCCACTTTACAAATGAAGAGACTGAGGCAAAGAAAGATGATGTAACTTACGCAAAGC";

my %codon_codes = (
    "UUU" => "f", "UUC" => "f", "UUA" => "l", "UUG" => "l",
    "CUU" => "l", "CUC" => "l", "CUA" => "l", "CUG" => "l",
    "AUU" => "i", "AUC" => "i", "AUA" => "i", "AUG" => "m",
    "GUU" => "v", "GUC" => "v", "GUA" => "v", "GUG" => "v",
    "UCU" => "s", "UCC" => "s", "UCA" => "s", "UCG" => "s",
    "CCU" => "p", "CCC" => "p", "CCA" => "p", "CCG" => "p",
    "ACU" => "t", "ACC" => "t", "ACA" => "t", "ACG" => "t", 
    "GCU" => "a", "GCC" => "a", "GCA" => "a", "GCG" => "a",
    "UAU" => "y", "UAC" => "y", "UAA" => " ", "UAG" => " ",
    "CAU" => "h", "CAC" => "h", "CAA" => "q", "CAG" => "q",
    "AAU" => "n", "AAC" => "n", "AAA" => "k", "AAG" => "k"
 );

my $rna_string = $dna_string;
$rna_string =~ tr/[tT]/U/;

my @all_codons = ($rna_string =~ m/.../g);

foreach my $next_codon(@all_codons){

    while ($next_codon =~ /AUG/gi){

        my $start = pos ($next_codon) -3;

        last unless $next_codon =~ /U(AA|GA|AG)/gi;

        my $stop = pos($next_codon);

        my $genelen = $stop - $start;

        my $gene = substr ($next_codon, $start, $genelen);

        print "\n" . join($start+1, $stop, $gene,) . "\n";
    }
}

Answer 1

-.

, , , -, . - ( $in_gene).

my $in_gene = 0;

foreach my $next_codon(@all_codons){
    if ($next_codon eq 'AUG') {
        $in_gene = 1;
    }
    elsif ($next_codon =~ m/U(AA|GA|AG)/) {
        $in_gene = 0;
    }
    elsif ($in_gene == 1) {
        my $aminoacid = $codon_codes{$next_codon};
        print "\n" and next unless defined $aminoacid;
        print $aminoacid;
    }
}

l
lqak
l
q
k